(mg/dl)
16/89 (mg/dl)
پرتقال 2
28/85 (mg/dl)
25/83 (mg/dl)
28/55 (mg/dl)
پرتقال 1
19/42 (mg/dl)
19/49 (mg/dl)
19/23 (mg/dl)
پرتقال 3
19/37 (mg/dl)
18/85 (mg/dl)
18/64 (mg/dl)
پرتقال 4
17/71 (mg/dl)
17/58 (mg/dl)
17/48 (mg/dl)
سيب 1
18//1 (mg/dl)
18/35 (mg/dl)
18/06 (mg/dl)
سيب 2
22/4 (mg/dl)
22/26 (mg/dl)
22/14 (mg/dl)
سيب 3
40 (mg/dl)
40/25 (mg/dl)
40/20 (mg/dl)
خاک مزرعه گندم
39/42 (mg/dl)
39/50 (mg/dl)
38/46 (mg/dl)
سبوس 1
28/51 (mg/dl)
28/37(mg/dl)
28/08(mg/dl)
سبوس 2
40/05 (mg/dl)
40/19 (mg/dl)
40/20 (mg/dl)
خاک در تماس 1
21/37 (mg/dl)
21/33 (mg/dl)
21/32 (mg/dl)
خاک در تماس 2
41/08 (mg/dl)
41/23 (mg/dl)
41/37 (mg/dl)
خاک باغ هلو

ميزان گلوکز بدست آمده بر اساس ميلي گرم بر دسي ليتر است

جدول 3-5 ميزان گلوکز بعد از 12 ساعت

510nm

500nm

490nm

نمونه
34/85 (mg/dl)
34/89 (mg/dl)
34/96 (mg/dl)
موز 1
29/71 (mg/dl)
29/70 (mg/dl)
29/72 (mg/dl)
ليمو
24/74 (mg/dl)
24/79 (mg/dl)
24/70 (mg/dl)
موز 2
32 (mg/dl)
32/00 (mg/dl)
32/05 (mg/dl)
خاک عميق 1
20/68 (mg/dl)
20/47 (mg/dl)
20/39 (mg/dl)
خاک عميق 2
41/71 (mg/dl)
41/86 (mg/dl)
41/95 (mg/dl)
پرتقال مثبت
17/71 (mg/dl)
17/58 (mg/dl)
17/48 (mg/dl)
پرتقال 2
34/85 (mg/dl)
34/89 (mg/dl)
34/96 (mg/dl)
پرتقال 1
20/28 (mg/dl)
20/18 (mg/dl)
20/16 (mg/dl)
پرتقال 3
20 (mg/dl)
19/89 (mg/dl)
19/81 (mg/dl)
پرتقال 4
20/45 (mg/dl)
20/47 (mg/dl)
20/39 (mg/dl)
سيب 1
18/98 (mg/dl)
18/91 (mg/dl)
18/64 (mg/dl)
سيب 2
27/6 (mg/dl)
27/68 (mg/dl)
27/50(mg/dl)
سيب 3
43/14 (mg/dl)
44/29 (mg/dl)
44/28 (mg/dl)
خاک مزرعه گندم
38/28 (mg/dl)
39/61 (mg/dl)
39/62 (mg/dl)
سبوس 1
28/68 (mg/dl)
28/71 (mg/dl)
28/55 (mg/dl)
سبوس 2
43/88 (mg/dl)
44/11 (mg/dl)
44/28 (mg/dl)
خاک در تماس1
26 (mg/dl)
25/95 (mg/dl)
25/93 (mg/dl)
خاک در تماس 2
45/82 (mg/dl)
46/02 (mg/dl)
46/03 (mg/dl)
خاک باغ هلو

جدول 3-6 ميزان گلوکز بعد از 24 ساعت

510nm

500nm

490nm

نمونه
38/28 (mg/dl)
38/52 (mg/dl)
37/35 (mg/dl)
موز 1
31/94 (mg/dl)
32/29 (mg/dl)
30/41 (mg/dl)
ليمو
28/05 (mg/dl)
28/43 (mg/dl)
28/49 (mg/dl)
موز 2
50/91 (mg/dl)
51/32(mg/dl)
51/74(mg/dl)
خاک عميق 1
24/91 (mg/dl)
25/43 (mg/dl)
24/59(mg/dl)
خاک عميق 2
46/17 (mg/dl)
46/08 (mg/dl)
43/06 (mg/dl)
پرتقال مثبت
36/05 (mg/dl)
36/62 (mg/dl)
35/66 (mg/dl)
پرتقال 1
18/8 (mg/dl)
19/03 (mg/dl)
18/64 (mg/dl)
پرتقال 2
20/28 (mg/dl)
20/76 (mg/dl)
20/39 (mg/dl)
پرتقال 3
23/14 (mg/dl)
23/06 (mg/dl)
23/07 (mg/dl)
پرتقال 4
21/71 (mg/dl)
22/14 (mg/dl)
20/57 (mg/dl)
سيب 1
22/22 (mg/dl)
23/24 (mg/dl)
21/56 (mg/dl)
سيب 2
30/85 (mg/dl)
31/02 (mg/dl)
29/33 (mg/dl)
سيب3
52 (mg/dl)
51/90 (mg/dl)
51/86 (mg/dl)
خاک مزرعه گندم
31/31 (mg/dl)
31/14 (mg/dl)
31/29 (mg/dl)
سبوس 2
44/28(mg/dl)
45/38(mg/dl)
42/83(mg/dl)
سبوس 1
31/82 (mg/dl)
32 (mg/dl)
31/23 (mg/dl)
خاک در تماس 1
47/88 (mg/dl)
48/90 (mg/dl)
48/13 (mg/dl)
خاک در تماس
50/4 (mg/dl)
50/80 (mg/dl)
50/69 (mg/dl)
خاک باغ هلو

پس از انجام مراحل فوق و رنگ آميزي انجام شده براي شناسايي هرچه بهتر باکتري هاي مولد آنزيم فروکتوزيل ترانسفراز از تست هاي بيوشيميايي(tsi،sim،mrvp،oxydase…..) بر اساس گرم مثبت و يا گرم منفي بودن ارگانيسم انجام گرفت که در فصل 4 به توصيف هرچه بهتر آنها پرداخته ايم.

3-3 بررسي مولکولي
پس از شناسايي باکتري هاي مولد آنزيم فروکتوزيل ترانسفراز سويه هايي که بيشترين فعاليت آنزيمي رادارند با روش PCR شناسا يي و ايزوله هاي برتر با روش 16 srDNA نيز ارزيا بي و تعيين هويت خواهند شد. که به انجام مراحل زير مي پردازيم:
مواد و وسايل مورد استفاده جهت استخراج DNA:
کيت استخراج DNA از شرکت سيناژن
ميکروتيوب هاي 5/0 و 5/1 و سر سمپلر 100-10 ميکروليتر
دستگاه ميکروسانتريفيوژ با دور بالا،دستگاه ورتکس،بايواسپکتوفتومتر براي تعيين مقدار DNA،Dry plate با دماي بين 10-2 درجه سانتيگراد
فريز -20 درجه سانتيگراد براي نگه داري DNA

3-3-1استخراج DNA از ايزوله:
استخراج DNA از سويه هاي باکتريايي به وسيله کيت تجاري
Geno PlusTM Genomic DNA Extraction Miniprep System ساخت شرکت Viogene (China) طبق دستور العمل ارائه شده به صورت زير انجام گرفت.
1- به پليت باکتريايي 180 ميکروليتر بافر LYS و 20 ميکروليتر پروتئيناز اضافه مي نماييم.
2- به مدت 30 دقيقه در دماي 60 درجه سانتي گراد انکوبه مي نماييم.
3- سپس 300 ميکروليتر بافر FX اضافه کرده و به خوبي با سروته کردن مخلوط مي نماييم.
4- سپس 200 ميکروليتر ايزوپروپانول اضافه کرده و خوب مخلوط مي نماييم.
5- مخلوط قبلي را به درون يک ستون سليکا کيت ريخته و در دور 8000 دور سانتريفوژ مي نماييم.
6- ستون را دو بار هر بار با 500 ميکروليتر بافر شستشو شستشو داده و در دور 8000 درو سانتريفوژ
مي نماييم.
7- ستون را در حداکثر دور به مدت 2 دقيقه سانتريفوژ کرده تا خشک شود.
8- ستون را درون يک ميکروتيوب 1.5 ميلي ليتري قرار داده و درون آن 60 ميکروليتر بافر elution گرم شده در دماي 60 درجه سانتي گراد اضافه مي نماييم.
9- 5 دقيقه صبر کرده و سپس در دور حداکثر به مدت 2 دقيقه سانتريفوژ مينماييم. حال DNA به درون ميکروتيوب منتقل شده و براي اعمال بعدي آماده مي باشد.

3-3-2 آناليز کيفي و کمي DNA استخراجي:
آناليز کيفي
مواد و وسايل مورد نياز: آگارز، بافرTBE 10X ، سمپلر و سر سمپلر، اتيديوم برمايد(10mg/ml)، تانک الکتروفورز، لودينگ بافر، قالب ژل آگارز، شانه.

3-3-3 طريقه ساخت بافرTBE 10X
مقدار 27 گرم Tris – base ، 75.13 گرم Boric acid و 10 ميلي ليتر EDTA 0.5 M را با هم مخلوط نموده و با آب مقطر استريل به حجم 250 سي سي مي رسانيم و در نهايت براي همگن شدن محيط ارلن به مدت 30 دقيقه در بن ماري در دماي 70 درجه قرار مي دهيم.

3-3-4 الکتروفورز
آناليز کيفي روي DNA استخراجي از طريق الکتروفورز روي ژل آگارز 1? انجام گرفت.
0.3 گرم آگاروز وزن شده را در 30 ميلي ليتر بافر TBE ، 1X با استفاده از حرارت حل نموده و مقدار 3 ميکروليتر رنگ فلورسنت اتيديوم برمايد به آن اضافه و در کاست ژل آگاروز همراه با شانه ريخته شد. پس از سفت شدن و برداشتن شانه ها نمونه ها همراه با لودينگ بافر درون چاهک ها لود گرديد.

شکل 3-4 دستگاه الکتروفورز

3-3-5 آناليز کمي
آناليز کمي از طريق بيو فتومتر روي رقت 1/10 نمونه استخراجي در طول موج هاي 260 ، 280 و 230 براي بررسي مقدار DNA، پروتئين و کربوهيدرات انجام شد.

3-3-6 واکنش PCR
3-3-6-1 اجزاي واکنش 16s rDNA-PCR

واکنش در حجم کل 50 ميکروليتر با ترکيبات زير مي باشد:

جدول 3-7 اجزاي واکنش 16s rDNA-PCR
19 ?l
dH2O
25 ?l
2X Master Mix (Fermentas)
1 ?l
Primer Mix (20 pmol)
5 ?l
Template
50 ?l
Total Volume
جدول 3-8 پرايمر ها و اندازه قطعه تکثيري
Ref
PCR Size
Primer sequence
Primer name
Weisburg

1500 bp
AGAGTTTGATCCTGGCTCAG
16s-F

ACGGCTACCTTGTTACGACTT
16s-R

جدول 3-9 برنامه دمايي ترموسايکر جهت تکثير ژن 16s rDNA

3 min
95 °C
دناتوراسيون اوليه
1 min
95 °C
دناتوراسيون
1.5 min
60 °C
دماي اتصال
2 min
72 °C
دماي گسترش
5 min
72 °C
گسترش نهايي
سيکل حرارتي مرحله 2 تا 4 ، 30 بار تکرار ميگردد .

3-3-7 آناليز کيفي محصولات PCR
با توجه به اندازه قطعات حاصل از هر يک از پرايمرها ، از ژل اگاروز 1? به منظور لود کردن نمونه ها و از لدر 100 تا 1500 جفت بازي (PZP Institute,Iran) براي شناسايي تکثير قطعه مورد نظر استفاده گرديد و نتايج از طريق ترانس لوميناتور و مانيتور مربوطه ثبت گرديد.
نتيجه آناليز کمي نشان داد که بطور متوسط در هر نمونه 90 نانوگرم DNA وجود داشته و ميزان پروتئين و کربوهيدرات ان جزئي و قابل چشم پوشي است. بر اساس غلظت حاصله مقدار 5 ميکروليتر DNA ژنومي براي PCR بعنوان الگو مناسب است.

3-5 دستگاه ترموسايکلر

4-1 جداسازي باکتري هاي مولد آنزيم فروکتوزيل ترانسفراز
پس از انجام آزمايشات در مجموع از 50 نمونه حاضر فقط 19باکتري از نمونه هاي محيطي جداسازي شدند که توانايي توليد آنزيم فروکتوزيل ترانسفراز را داشته اند.بعد از انجام تست هاي اوليه جهت شناسايي مشخص شد که 19 باکتري جداشده از نمونه هاي محيطي گرم مثبت بودند.

(الف) (ب)
شکل 4-1 شکل ميکروسکوپي کلني ها پس از رنگ آميزي (الف) سيب (ب) خاک

4-2 شناسايي فنوتيپي باکتري هاي مولد آنزيم فروکتوزيل ترانسفراز
نتايج مربوط به شناسايي اوليه باکتري هاي جداسازي شده از نمونه هاي محيطي در جدول 4-1 آمده است پس از انجام اين تست ها به کمک کتاب اطلس ميکروب شناسي باکتري هاي جدا شده را در جدول 4-2 شناسايي شد.

جدول 4-1 شکل ميکروسکوپي کلني ها پس از رنگ آميزي

مرفولوژي

محيط

نمونه
باسيل گرم مثبت
MC.NA
سبوس 1
باسيل گرم مثبت
MC.NA
سبوس 2
باسيل گرم مثبت
MC.NA
خاک در تماس ميوه1
باسيل گرم مثبت
MC.NA
خاک در تماس ميوه2
باسيل گرم مثبت
MC.NA
پرتقال مثبت
باسيل گرم مثبت
MC.NA
پرتقال 1
باسيل گرم مثبت اسپور دار
MC.NA
پرتقال 2
باسيل گرم مثبت اسپور دار
MC.NA
پرتقال 3
باسيل گرم مثبت اسپور دار متورم
MC.NA
پرتقال 4
باسيل گرم مثبت اسپور دار
MC.NA
موز 1
باسيل گرم مثبت اسپور دار
MC.NA
ليمو
باسيل گرم مثبت اسپور دار
MC.NA
موز 2
باسيل گرم مثبت صاف
MC.NA
خاک عميق 1
باسيل گرم مثبت صاف
MC.NA
خاک عميق 2
باسيل گرم مثبت اسپور دار
MC.NA
سيب 1
باسيل گرم مثبت اسپور دار
MC.NA
سيب 2
باسيل گرم مثبت اسپور دار
MC.NA
سيب 3
باسيل گرم مثبت اسپور دار صاف
MC.NA
خاک باغ هلو
باسيل گرم مثبت اسپور دار صاف
MC.NA
خاک مزرعه گندم

جدول4-2 نتايج تست هاي بيوشيميايي براي باکتري هاي گرم مثبت

نمونه

TSI

SIM

اوره

نشاسته

سيترات

کازئين

اکسيداز

کاتالاز

ژلاتين

MR

VP

خاک در تماس 1

al/a

گاز

ح +
ان –

+

+

+

+

خاک در تماس 2
a/a

گاز –

//

+

+

+

+

خاک عميق 1
a/a

گاز

//

+

+

+

+

+

+

+

+

خاک عميق 2
a/a

گاز +

//

+

+

+

+

+

+

+

+

سبوس 1

a/a

گاز –

//

+

+

+

+

+

+

سبوس 2
a/a

گاز +

//

+

+

+

+

پرتقال مثبت
Al/al

گاز –

//

+

+

+

+

پرتقال1
a/a

گاز –

//

+

+

+

+

+

+

+

پرتقال 2

a/a

گاز –

//

+

+

متن کامل در سایت sabzfile.com

دیدگاهتان را بنویسید